NCBI SRA Fastq

Back to Support Hub

NCBI SRA sourced fastq data

In these FASTQ data:

  • The quality score identifier (+) is sometimes not a match for the sequence identifier (@).
  • The forward and reverse reads may be joined and need to be seperated into distinct datasets.
  • Format problems of any kind can cause tool failures and/or unexpected results.
  • Fix the problems before running any other tools (including FastQC, Fastq Groomer, or other QA tools)

Inconsistent sequence (@) and quality (+) identifiers

Example

Notice that the sequence identifier for the quality score name ("+" line) is NOT one of these accepted formats:

  • The same exact content is present for both the quality score name and the sequence name ("@" line)
  • Quality score name is a single plus sign ("+")
@MG00HS05:491:C7450ACXX:4:1101:1240:2223_forward/1
TTTGTGACTAATTGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGCAAAGCATTCCAATAAGGGTTTTTATGTTTGCAAAGGAGAGTTTGTCTA
+SRR5330501.1 MG00HS05:491:C7450ACXX:4:1101:1240:2223 length=101
:??>D>,,,CDD8,C<EEI@@C;3<AF9:C+22+2A4E:11@C11?D9*?BDB*009)9*08?D9BEIDEI.@CA=6=A@A?D===@?;.;?>AAA;>>A#

Solution

Correct the format by running the tool Replace Text in entire line with these options:

Find pattern: ^\+SRR.+

Replace with: +

Note: If the quality score line is named like "+ERR" instead (or other valid options), modify the pattern search to match.

Joined forward and reverse reads

coming next

Example

Solution